HA_DD-N-mTagBFP2-QtSig
(Plasmid
#236776)
-
PurposeExpresses the blue fluorescent protein mTagBFP2 fused to the encapsulation signal for QtEnc and fused to a degron signal for proteasomal degradation when not encapsulated.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA_Zeo
- Total vector size (bp) -2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDD-N, TagBFP, QtSig
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA_DD-N-mTagBFP2-QtSig was a gift from Gil Westmeyer (Addgene plasmid # 236776 ; http://n2t.net/addgene:236776 ; RRID:Addgene_236776) -
For your References section:
Multiplexed genetic tags for electron and fluorescence microscopy. Berezin O, Piovesan A, Graf R, Samara E, Sigmund F, Westmeyer GG. Nat Protoc. 2025 Nov 19. doi: 10.1038/s41596-025-01260-7. 10.1038/s41596-025-01260-7 PubMed 41261217