pMG008_mCherry_P2A
(Plasmid
#237216)
-
PurposeFluorescent reporter codon optimized for Dictyostelid species
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 2341
- Total vector size (bp) 3646
-
Vector typeCloning
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-P2A
-
SpeciesSynthetic
-
Tags
/ Fusion Proteins
- SV40-NLS (N terminal on insert)
- nuleoplasmin NLS (N terminal on insert)
- 3xFLAG-tag (N terminal on insert)
- HA-tag (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMG008_mCherry_P2A was a gift from Jordi van Gestel (Addgene plasmid # 237216 ; http://n2t.net/addgene:237216 ; RRID:Addgene_237216)