Skip to main content

pInducer20 SNAT2-eGFP WT (wildtype)
(Plasmid #237228)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237228 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pInducer20-Blast
  • Backbone manufacturer
    Jean Cook (Addgene plasmid #109334)
  • Backbone size w/o insert (bp) 12215
  • Total vector size (bp) 12840
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC38A2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2274
  • Mutation
    Silent mutations to prevent targeting by sgRNA sequence: TAATCTGAGCAATGCGATTG
  • Entrez Gene
    SLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
  • Promoter TRE
  • Tag / Fusion Protein
    • eGFP

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pInducer20 SNAT2-eGFP WT (wildtype) was a gift from Seth Parker (Addgene plasmid # 237228 ; http://n2t.net/addgene:237228 ; RRID:Addgene_237228)
  • For your References section:

    N-linked glycosylation regulates SNAT2 trafficking and stability in pancreatic ductal adenocarcinoma cells. Koe JC, Pashaoskooie K, Johal D, Zhong YC, Wu C, Parker SJ. Am J Physiol Cell Physiol. 2026 Jun 29. doi: 10.1152/ajpcell.00060.2026. 10.1152/ajpcell.00060.2026 PubMed 42370970