Skip to main content

pShuttle-CMV-Flag-SREBP-1c
(Plasmid #237348)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237348 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pShuttleCMV
  • Backbone manufacturer
    Agilent (AdEasy)
  • Backbone size w/o insert (bp) 7443
  • Total vector size (bp) 10945
  • Vector type
    Mouse Targeting, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SREBF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3502
  • Entrez Gene
    SREBF1 (a.k.a. HMD, IFAP2, SREBP1, bHLHd1)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag tag

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pShuttle-CMV-Flag-SREBP-1c was a gift from Gerald Höfler (Addgene plasmid # 237348 ; http://n2t.net/addgene:237348 ; RRID:Addgene_237348)
  • For your References section:

    Lipolysis-derived fatty acids are needed for homeostatic control of sterol element-binding protein-1c driven hepatic lipogenesis. Pena de la Sancha P, Wieser BI, Schauer S, Reicher H, Sattler W, Breinbauer R, Schweiger M, Lechleitner M, Frank S, Zechner R, Kratky D, Espenshade PJ, Hoefler G, Vesely PW. Commun Biol. 2025 Apr 9;8(1):588. doi: 10.1038/s42003-025-08002-1. 10.1038/s42003-025-08002-1 PubMed 40205023