pShuttle-CMV-Flag-SREBP-1c
(Plasmid
#237348)
-
PurposeAdenoviral-SREBP-1c cleavage-activation reporter system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepShuttleCMV
-
Backbone manufacturerAgilent (AdEasy)
- Backbone size w/o insert (bp) 7443
- Total vector size (bp) 10945
-
Vector typeMouse Targeting, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSREBF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3502
-
Entrez GeneSREBF1 (a.k.a. HMD, IFAP2, SREBP1, bHLHd1)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag tag
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pShuttle-CMV-Flag-SREBP-1c was a gift from Gerald Höfler (Addgene plasmid # 237348 ; http://n2t.net/addgene:237348 ; RRID:Addgene_237348) -
For your References section:
Lipolysis-derived fatty acids are needed for homeostatic control of sterol element-binding protein-1c driven hepatic lipogenesis. Pena de la Sancha P, Wieser BI, Schauer S, Reicher H, Sattler W, Breinbauer R, Schweiger M, Lechleitner M, Frank S, Zechner R, Kratky D, Espenshade PJ, Hoefler G, Vesely PW. Commun Biol. 2025 Apr 9;8(1):588. doi: 10.1038/s42003-025-08002-1. 10.1038/s42003-025-08002-1 PubMed 40205023