MIGR1-U6gRNA1-Filler-v2
(Plasmid
#237400)
-
Purpose(Empty Backbone) For inserting a single guide RNA or later cloning two U6-gRNA cassettes with MIGR1-U6gRNA1-Filler-v1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMIGR1
-
Backbone manufacturerWarren Pear (Addgene #27490)
- Backbone size (bp) 5100
-
Vector typeMammalian Expression, Retroviral, CRISPR
- Promoter U6, PGK
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer cccttgaacctcctcgttcgacc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector is designed for dual sgRNA cloning to delete cis-regulatory elements when paired with MIGR1-U6gRNA1-Filler-v1 (237399). It enables direct transfer of the U6gRNA cassette (containing the inserted gRNA) between vectors by restriction digestion and ligation. It can also be used for individual sgRNA cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MIGR1-U6gRNA1-Filler-v2 was a gift from Zuoming Sun (Addgene plasmid # 237400 ; http://n2t.net/addgene:237400 ; RRID:Addgene_237400) -
For your References section:
Protocol for CRISPR-mediated deletion of cis-regulatory element in murine Th17 cells for in vivo assessment of effector function. Zhong X, Wu H, Wang G, Sun Z. STAR Protoc. 2025 Jun 20;6(2):103831. doi: 10.1016/j.xpro.2025.103831. Epub 2025 May 20. 10.1016/j.xpro.2025.103831 PubMed 40397576