MIGR1-U6gRNA2-Filler
(Plasmid #237401)

• Purpose: For the sequential insertion of two guide RNAs into two U6gRNA cassettes.
• Depositing Lab: Zuoming Sun
• Publication: Zhong et al STAR Protoc. 2025 Jun 20;6(2):103831. doi: 10.1016/j.xpro.2025.103831. Epub 2025 May 20.

Backbone

• Vector backbone: MIGR1
• Backbone manufacturer: Warren Pear (Addgene #27490)
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 8336
• Modifications to backbone: Damage the BspMI site
• Vector type: Mammalian Expression, Retroviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: U6gRNA-1
• Alt name: U6 promoter-driven sgRNA-2
• Species: Synthetic
• Insert Size (bp): 980
• Promoter: U6 promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cccttgaacctcctcgttcgacc

Gene/Insert 2

• Gene/Insert name: U6gRNA-2
• Alt name: U6 promoter-driven sgRNA-2
• Species: Synthetic
• Insert Size (bp): 979
• Promoter: U6 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TTGCACAGCGCGTATGTGAA
• 3′ sequencing primer: GCTAAAGCGCATGCTCCAGAC

Gene/Insert 3

• Gene/Insert name: PGK-TagBFP
• Alt name: PGK promoter-driven TagBFP
• Insert Size (bp): 1242
• Promoter: PGK promoter

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: CATTCTGCACGCTTCAAAAG
• 3′ sequencing primer: CCTCGACCACCTTGATTCTCA

Resource Information

• Supplemental Documents:
  • MIGR1-U6gRNA2-Filler.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector is designed for dual sgRNA cloning to delete cis-regulatory elements through the sequential insertion of two gRNAs, using BbsI for U6gRNA1 and BspMI for U6gRNA2. This process can potentially be accomplished via GoldenGate Assembly in a single reaction.
For Sanger sequencing:
U6gRNA-1 can be directly sequenced using the 5' sequencing primer: CCCTTGAACCTCCTCGTTCGACC.
U6gRNA-2 sequencing is recommended using the 3' sequencing primer: GCTAAAGCGCATGCTCCAGAC.
PGK-TagBFP should be sequenced twice: once using the 5' sequencing primer for PGK (CATTCTGCACGCTTCAAAAG) and again using the 3' sequencing primer for TagBFP (CCTCGACCACCTTGATTCTCA).