MIGR1-U6gRNA2-Filler
(Plasmid
#237401)
-
PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMIGR1
-
Backbone manufacturerWarren Pear (Addgene #27490)
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 8336
-
Modifications to backboneDamage the BspMI site
-
Vector typeMammalian Expression, Retroviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6gRNA-1
-
Alt nameU6 promoter-driven sgRNA-2
-
SpeciesSynthetic
-
Insert Size (bp)980
- Promoter U6 promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cccttgaacctcctcgttcgacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6gRNA-2
-
Alt nameU6 promoter-driven sgRNA-2
-
SpeciesSynthetic
-
Insert Size (bp)979
- Promoter U6 promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TTGCACAGCGCGTATGTGAA
- 3′ sequencing primer GCTAAAGCGCATGCTCCAGAC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePGK-TagBFP
-
Alt namePGK promoter-driven TagBFP
-
Insert Size (bp)1242
- Promoter PGK promoter
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CATTCTGCACGCTTCAAAAG
- 3′ sequencing primer CCTCGACCACCTTGATTCTCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector is designed for dual sgRNA cloning to delete cis-regulatory elements through the sequential insertion of two gRNAs, using BbsI for U6gRNA1 and BspMI for U6gRNA2. This process can potentially be accomplished via GoldenGate Assembly in a single reaction.
For Sanger sequencing:
U6gRNA-1 can be directly sequenced using the 5' sequencing primer: CCCTTGAACCTCCTCGTTCGACC.
U6gRNA-2 sequencing is recommended using the 3' sequencing primer: GCTAAAGCGCATGCTCCAGAC.
PGK-TagBFP should be sequenced twice: once using the 5' sequencing primer for PGK (CATTCTGCACGCTTCAAAAG) and again using the 3' sequencing primer for TagBFP (CCTCGACCACCTTGATTCTCA).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MIGR1-U6gRNA2-Filler was a gift from Zuoming Sun (Addgene plasmid # 237401 ; http://n2t.net/addgene:237401 ; RRID:Addgene_237401) -
For your References section:
Protocol for CRISPR-mediated deletion of cis-regulatory element in murine Th17 cells for in vivo assessment of effector function. Zhong X, Wu H, Wang G, Sun Z. STAR Protoc. 2025 Jun 20;6(2):103831. doi: 10.1016/j.xpro.2025.103831. Epub 2025 May 20. 10.1016/j.xpro.2025.103831 PubMed 40397576