pGEMHE-MmCENP-W
(Plasmid
#237433)
-
PurposeExpresses Mus musculus CENP-W; untagged; made for in vitro transcription
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEMHE
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMus musculus CENP-W
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)258
-
Entrez GeneCenpw (a.k.a. 2610036L11Rik, Cug2)
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCTTCGCTATTACGCCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-MmCENP-W was a gift from Michael Lampson (Addgene plasmid # 237433 ; http://n2t.net/addgene:237433 ; RRID:Addgene_237433) -
For your References section:
Adaptive evolution of CENP-T modulates centromere binding. Dudka D, Nguyen AL, Boese KG, Marescal O, Akins RB, Black BE, Cheeseman IM, Lampson MA. Curr Biol. 2025 Mar 10;35(5):1012-1022.e5. doi: 10.1016/j.cub.2025.01.017. Epub 2025 Feb 12. 10.1016/j.cub.2025.01.017 PubMed 39947176