pGEMHE-Trim21-OLLAS
(Plasmid
#237438)
-
PurposeExpresses mouse Trim21 ubiquitin ligase tagged with OLLAS at C-term; made for in vitro transcription (T7 promoter)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEMHE
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTrim21
-
SpeciesM. musculus (mouse)
-
Entrez GeneTrim21 (a.k.a. Ro52, Ssa1)
- Promoter T7
-
Tag
/ Fusion Protein
- OLLAS (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCTTCGCTATTACGCCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-Trim21-OLLAS was a gift from Michael Lampson (Addgene plasmid # 237438 ; http://n2t.net/addgene:237438 ; RRID:Addgene_237438) -
For your References section:
Satellite DNA shapes dictate pericentromere packaging in female meiosis. Dudka D, Dawicki-McKenna JM, Sun X, Beeravolu K, Akera T, Lampson MA, Black BE. Nature. 2025 Feb;638(8051):814-822. doi: 10.1038/s41586-024-08374-0. Epub 2025 Jan 8. 10.1038/s41586-024-08374-0 PubMed 39779853