pX461-ABE8e-nSpCas9-Intergenic sgRNA
(Plasmid
#237463)
-
PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSpCas9) and gRNA control targeting Intergenic site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459v2
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 62988)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntergenic sgRNA
-
gRNA/shRNA sequenceTTGACTGCACACAACTGGGC
-
SpeciesOther
- Promoter chicken beta-actin promoter & U6
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX461-ABE8e-nSpCas9-Intergenic sgRNA was a gift from Thomas Gonatopoulos-Pournatzis (Addgene plasmid # 237463 ; http://n2t.net/addgene:237463 ; RRID:Addgene_237463) -
For your References section:
Single-cell exon deletion profiling reveals splicing events that shape gene expression and cell state dynamics. Kumari B, Damodaran AP, Guiblet WM, Xiao MS, Behera AK, On TA, McIntosh CE, Teszler M, Holloway C, Le S, Parab N, Zhao Y, Aregger M, Gonatopoulos-Pournatzis T. Nat Commun. 2026 Feb 3;17(1):1218. doi: 10.1038/s41467-026-68774-w. 10.1038/s41467-026-68774-w PubMed 41633991