Skip to main content

pX461-evoCDA1-nSpCas9-Intergenic sgRNA
(Plasmid #237464)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237464 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX459v2
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 62988)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intergenic sgRNA
  • gRNA/shRNA sequence
    TTGACTGCACACAACTGGGC
  • Species
    Other
  • Promoter chicken beta-actin promoter & U6

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX461-evoCDA1-nSpCas9-Intergenic sgRNA was a gift from Thomas Gonatopoulos-Pournatzis (Addgene plasmid # 237464 ; http://n2t.net/addgene:237464 ; RRID:Addgene_237464)
  • For your References section:

    Single-cell exon deletion profiling reveals splicing events that shape gene expression and cell state dynamics. Kumari B, Damodaran AP, Guiblet WM, Xiao MS, Behera AK, On TA, McIntosh CE, Teszler M, Holloway C, Le S, Parab N, Zhao Y, Aregger M, Gonatopoulos-Pournatzis T. Nat Commun. 2026 Feb 3;17(1):1218. doi: 10.1038/s41467-026-68774-w. 10.1038/s41467-026-68774-w PubMed 41633991