pORTMAGE-Cc2
(Plasmid
#237799)
-
PurposeGuide RNA production in Caulobacter crescentus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 237799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBBR1
-
Vector typeCRISPR ; Expression in Caulobacter crescentus
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceGTTTTAGAGCTGTGAAAACAGCGAGTTAAAATAAGGCTTAGTCCGTACTCAACTTGAAAAGGTGGCACCGATTCGGTGTTTTTTTT
Resource Information
-
Supplemental Documents
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORTMAGE-Cc2 was a gift from Timothy Wannier (Addgene plasmid # 237799) -
For your References section:
A diverse single-stranded DNA-annealing protein library enables efficient genome editing across bacterial phyla. Filsinger GT, Mychack A, Lyerly E, Henriksen C, Bartlett TM, Kuchwara H, Eitzinger S, Bernhardt TG, Walker S, Church GM, Wannier TM. Proc Natl Acad Sci U S A. 2025 Apr 29;122(17):e2414342122. doi: 10.1073/pnas.2414342122. Epub 2025 Apr 21. 10.1073/pnas.2414342122 PubMed 40258142