EML8553_ pEML41003-tufBpst4-15
(Plasmid
#237866)
-
PurposeA suicide vector for replacing 4th to 15th amino acids of tufB
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEML8543_pEML41003
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametufB
-
SpeciesAgrobacterium fabrum str. C58
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GATGCCTGCCGAATTCG
- 3′ sequencing primer TCTGAGGTCATTACTGGATCTA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EML8553_ pEML41003-tufBpst4-15 was a gift from Erh-Min Lai (Addgene plasmid # 237866 ; http://n2t.net/addgene:237866 ; RRID:Addgene_237866) -
For your References section:
Floral stage optimization and immune evasion enhance Agrobacterium-mediated genome editing in Arabidopsis. Liu MS, Huang TK, Wang YC, Wang SC, Wu CH, Kuo CH, Lai EM. New Phytol. 2025 Nov 30. doi: 10.1111/nph.70795. 10.1111/nph.70795 PubMed 41321035