Skip to main content

EML8553_ pEML41003-tufBpst4-15
(Plasmid #237866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237866 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EML8543_pEML41003

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tufB
  • Species
    Agrobacterium fabrum str. C58

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GATGCCTGCCGAATTCG
  • 3′ sequencing primer TCTGAGGTCATTACTGGATCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EML8553_ pEML41003-tufBpst4-15 was a gift from Erh-Min Lai (Addgene plasmid # 237866 ; http://n2t.net/addgene:237866 ; RRID:Addgene_237866)
  • For your References section:

    Floral stage optimization and immune evasion enhance Agrobacterium-mediated genome editing in Arabidopsis. Liu MS, Huang TK, Wang YC, Wang SC, Wu CH, Kuo CH, Lai EM. New Phytol. 2025 Nov 30. doi: 10.1111/nph.70795. 10.1111/nph.70795 PubMed 41321035