pAAV-TRE-fDIO-mem-seTurboID-IRES-tTA
(Plasmid
#237889)
-
PurposeAmplifier AAV vector of Dual-AAV sparse labeling system encoding membrane-tethered seTurboID
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 237889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7176
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemem-seTurboID
-
SpeciesSynthetic
-
Insert Size (bp)1242
- Promoter TRE
-
Tags
/ Fusion Proteins
- FLAG tag (N terminal on insert)
- GAP43 palmitoylation signal (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGACAGGGCCAGGTTTCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE-fDIO-mem-seTurboID-IRES-tTA was a gift from Rui Lin (Addgene plasmid # 237889 ; http://n2t.net/addgene:237889 ; RRID:Addgene_237889)