pEGFP-AAK1-Ser624Ala
(Plasmid
#237899)
-
PurposeExpression of GFP-AAK1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFPC3
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7584
-
Modifications to backboneSerine residue at 625 is mutated to Alanine
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAP2-associated protein kinase 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2880
-
MutationSerine 624 changed to alanine
-
GenBank IDNM_014911.5
-
Entrez GeneAAK1
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xhoi (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-AAK1-Ser624Ala was a gift from Eleanor Coffey (Addgene plasmid # 237899 ; http://n2t.net/addgene:237899 ; RRID:Addgene_237899)