Skip to main content
Addgene

pMJ1.19 (AAVS1 RNA donor in pCDNA3.1)
(Plasmid #238007)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 238007 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Vector type
    Mammalian Expression ; RNA donor to study RT-DSBR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAVS1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    454
  • Mutation
    3bp insertion signature (ATC) at Cas9 cut site interrupted by the beta globin intron
  • GenBank ID
  • Entrez Gene
    AAVS1 (a.k.a. AAV)
  • Entrez Gene
    PPP1R12C (a.k.a. AAVS1, LENG3, MBS85, p84, p85)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer TGGGAGGTCTATATAAGCAGAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJ1.19 (AAVS1 RNA donor in pCDNA3.1) was a gift from Simon Powell & Agnel Sfeir (Addgene plasmid # 238007 ; http://n2t.net/addgene:238007 ; RRID:Addgene_238007)

  • For your References section:

    RNA transcripts serve as a template for double-strand break repair in human cells. Jalan M, Brambati A, Shah H, McDermott N, Patel J, Zhu Y, Doymaz A, Wu J, Anderson KS, Gazzo A, Pareja F, Yamaguchi TN, Vougiouklakis T, Ahmed-Seghir S, Steinberg P, Neiman-Golden A, Azeroglu B, Gomez-Aguilar J, da Silva EM, Hussain S, Higginson D, Boutros PC, Riaz N, Reis-Filho JS, Powell SN, Sfeir A. Nat Commun. 2025 May 10;16(1):4349. doi: 10.1038/s41467-025-59510-x. 10.1038/s41467-025-59510-x PubMed 40348775
Related items: