pMJ1.19 (AAVS1 RNA donor in pCDNA3.1)
(Plasmid
#238007)
-
Purpose300bp donor RNA complementary to Cas9 cut site at AAVS1 (Addgene plasmid #72833) with intronic sequence intervening the 3bp insertion signature (ATC). Can be used to measure RT-DSBR in human cells.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Vector typeMammalian Expression ; RNA donor to study RT-DSBR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer TGGGAGGTCTATATAAGCAGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJ1.19 (AAVS1 RNA donor in pCDNA3.1) was a gift from Simon Powell & Agnel Sfeir (Addgene plasmid # 238007 ; http://n2t.net/addgene:238007 ; RRID:Addgene_238007) -
For your References section:
RNA transcripts serve as a template for double-strand break repair in human cells. Jalan M, Brambati A, Shah H, McDermott N, Patel J, Zhu Y, Doymaz A, Wu J, Anderson KS, Gazzo A, Pareja F, Yamaguchi TN, Vougiouklakis T, Ahmed-Seghir S, Steinberg P, Neiman-Golden A, Azeroglu B, Gomez-Aguilar J, da Silva EM, Hussain S, Higginson D, Boutros PC, Riaz N, Reis-Filho JS, Powell SN, Sfeir A. Nat Commun. 2025 May 10;16(1):4349. doi: 10.1038/s41467-025-59510-x. 10.1038/s41467-025-59510-x PubMed 40348775