ADEPT-pTarget-Msp5
(Plasmid
#238038)
-
PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238038 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneADEPT-pTarget
- Backbone size w/o insert (bp) 3337
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
gRNA/shRNA sequenceguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc
-
SpeciesSynthetic
-
Insert Size (bp)714
- Promoter lac
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ADEPT-pTarget-Msp5 was a gift from Lingchong You (Addgene plasmid # 238038 ; http://n2t.net/addgene:238038 ; RRID:Addgene_238038) -
For your References section:
Population-level amplification of gene regulation by programmable gene transfer. Son HI, Hamrick GS, Shende AR, Kim K, Yang K, Huang TJ, You L. Nat Chem Biol. 2025 Jan 8. doi: 10.1038/s41589-024-01817-9. 10.1038/s41589-024-01817-9 PubMed 39779901