pEGFP-INPP5F-Ser940Asp
(Plasmid
#238073)
-
PurposeExpression of GFP-INPP5F in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEFPF-C3
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 8082
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameINPP5F
-
Alt nameSac2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3417
-
MutationSerine 940 changed to aspartate
-
GenBank IDEAW49380.1
-
Entrez GeneINPP5F (a.k.a. MSTP007, MSTPO47, SAC2, hSAC2)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-INPP5F-Ser940Asp was a gift from Eleanor Coffey (Addgene plasmid # 238073 ; http://n2t.net/addgene:238073 ; RRID:Addgene_238073)