pLCKO-CMV-Blasticidin-P2A-3xHA-TMEM106B_Hamster
(Plasmid
#238131)
-
PurposeThis plasmid encodes the full-length hamster (Mesocricetus auratus) TMEM106B protein fused with a 3xHA tag, along with an N-terminal blasticidin selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238131 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLCKO
- Backbone size w/o insert (bp) 9153
- Total vector size (bp) 10530
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTMEM106B
-
SpeciesMesocricetus auratus (hamster)
-
Insert Size (bp)1377
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- Blasticidin-P2A-3xHA (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLCKO-CMV-Blasticidin-P2A-3xHA-TMEM106B_Hamster was a gift from Dirk Daelemans (Addgene plasmid # 238131 ; http://n2t.net/addgene:238131 ; RRID:Addgene_238131) -
For your References section:
TMEM106B is a receptor mediating ACE2-independent SARS-CoV-2 cell entry. Baggen J, Jacquemyn M, Persoons L, Vanstreels E, Pye VE, Wrobel AG, Calvaresi V, Martin SR, Roustan C, Cronin NB, Reading E, Thibaut HJ, Vercruysse T, Maes P, De Smet F, Yee A, Nivitchanyong T, Roell M, Franco-Hernandez N, Rhinn H, Mamchak AA, Ah Young-Chapon M, Brown E, Cherepanov P, Daelemans D. Cell. 2023 Aug 3;186(16):3427-3442.e22. doi: 10.1016/j.cell.2023.06.005. Epub 2023 Jul 7. 10.1016/j.cell.2023.06.005 PubMed 37421949