pRCA803 - pBA904 Puro-T2A-GFP KLF5 g1 CRISPRa guide (pRCA360 backbone) 666
(Plasmid
#238172)
-
PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct Capture
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 238172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRCA360 - pBA904 Puro-T2A-GFP
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKLF5 sgRNA CRISPRa
-
gRNA/shRNA sequenceGAAGTTGTGTACAAACTGCG
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneKLF5 (a.k.a. BTEB2, CKLF, IKLF)
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.07.31.606073 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRCA803 - pBA904 Puro-T2A-GFP KLF5 g1 CRISPRa guide (pRCA360 backbone) 666 was a gift from Thomas Norman (Addgene plasmid # 238172 ; http://n2t.net/addgene:238172 ; RRID:Addgene_238172) -
For your References section:
Comprehensive transcription factor perturbations recapitulate fibroblast transcriptional states. Southard KM, Ardy RC, Tang A, O'Sullivan DD, Metzner E, Guruvayurappan K, Norman TM. bioRxiv [Preprint]. 2024 Aug 3:2024.07.31.606073. doi: 10.1101/2024.07.31.606073. 10.1101/2024.07.31.606073 PubMed 39131349