Skip to main content

pRCA815 - pBA904 Puro-T2A-GFP ZNF296 g5 CRISPRa guide (pRCA360 backbone) 695
(Plasmid #238178)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 238178 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRCA360 - pBA904 Puro-T2A-GFP
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ZNF296 sgRNA CRISPRa
  • gRNA/shRNA sequence
    GACACTGCCTAGATTGAGTT
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    ZNF296 (a.k.a. ZFP296, ZNF342)
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.07.31.606073 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRCA815 - pBA904 Puro-T2A-GFP ZNF296 g5 CRISPRa guide (pRCA360 backbone) 695 was a gift from Thomas Norman (Addgene plasmid # 238178 ; http://n2t.net/addgene:238178 ; RRID:Addgene_238178)
  • For your References section:

    Comprehensive transcription factor perturbations recapitulate fibroblast transcriptional states. Southard KM, Ardy RC, Tang A, O'Sullivan DD, Metzner E, Guruvayurappan K, Norman TM. Nat Genet. 2025 Aug 6. doi: 10.1038/s41588-025-02284-1. 10.1038/s41588-025-02284-1 PubMed 40770575