pMIIS948-CXCR4
(Plasmid
#238213)
-
PurposeTasR tigRNA expression to target CXCR4 under U6 promoter in human cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 238213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametigRNA
-
gRNA/shRNA sequenceAGCCAAAUGUACAAUGAAACCCAUUCAAACGUUGCG
-
SpeciesOther
-
Insert Size (bp)36
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIIS948-CXCR4 was a gift from Feng Zhang (Addgene plasmid # 238213 ; http://n2t.net/addgene:238213 ; RRID:Addgene_238213) -
For your References section:
TIGR-Tas: A family of modular RNA-guided DNA-targeting systems in prokaryotes and their viruses. Faure G, Saito M, Wilkinson ME, Quinones-Olvera N, Xu P, Flam-Shepherd D, Kim S, Reddy N, Zhu S, Evgeniou L, Koonin EV, Macrae RK, Zhang F. Science. 2025 Feb 27:eadv9789. doi: 10.1126/science.adv9789. 10.1126/science.adv9789 PubMed 40014690