pX458_mCherry-NPM1-gRNA for HCT116
(Plasmid
#238249)
-
PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX458-mCherry
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNPM1
-
gRNA/shRNA sequencegagttaccgaaaagatagttc
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458_mCherry-NPM1-gRNA for HCT116 was a gift from Denes Hnisz (Addgene plasmid # 238249 ; http://n2t.net/addgene:238249 ; RRID:Addgene_238249) -
For your References section:
Probing condensate microenvironments with a micropeptide killswitch. Zhang Y, Stoppelkamp I, Fernandez-Pernas P, Allram M, Charman M, Magalhaes AP, Piedavent-Salomon M, Sommer G, Sung YC, Meyer K, Grams N, Halko E, Dongre S, Meierhofer D, Malszycki M, Ilik IA, Aktas T, Kraushar ML, Vastenhouw N, Weitzman MD, Grebien F, Niskanen H, Hnisz D. Nature. 2025 Jun 4. doi: 10.1038/s41586-025-09141-5. 10.1038/s41586-025-09141-5 PubMed 40468084