Skip to main content

pX458_mCherry-NPM1-gRNA for HCT116
(Plasmid #238249)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 238249 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX458-mCherry
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NPM1
  • gRNA/shRNA sequence
    gagttaccgaaaagatagttc
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458_mCherry-NPM1-gRNA for HCT116 was a gift from Denes Hnisz (Addgene plasmid # 238249 ; http://n2t.net/addgene:238249 ; RRID:Addgene_238249)
  • For your References section:

    Probing condensate microenvironments with a micropeptide killswitch. Zhang Y, Stoppelkamp I, Fernandez-Pernas P, Allram M, Charman M, Magalhaes AP, Piedavent-Salomon M, Sommer G, Sung YC, Meyer K, Grams N, Halko E, Dongre S, Meierhofer D, Malszycki M, Ilik IA, Aktas T, Kraushar ML, Vastenhouw N, Weitzman MD, Grebien F, Niskanen H, Hnisz D. Nature. 2025 Jun 4. doi: 10.1038/s41586-025-09141-5. 10.1038/s41586-025-09141-5 PubMed 40468084