pTol1-U6abc_amhc(myh6)_cmlc2-nmKate
(Plasmid
#238375)
-
PurposeDrives expression of 3 different gRNAs targeting amhc (myh6), and expression of nclear mKate in cardiomyocytes.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTol1-based backbone
- Total vector size (bp) 6610
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenuclear mKate/3 gRNAs targeting amhc
-
gRNA/shRNA sequenceAmhc gA: gggcgcctggaggaggcagg; Amhc gB: ggGGAGCAGGCCGAGCCCGA; Amhc gC: ggGCAGGAGTTGCATCCGTT
-
SpeciesD. rerio (zebrafish)
- Promoter cmlc2 (nmKate); U6 (gRNAs)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol1-U6abc_amhc(myh6)_cmlc2-nmKate was a gift from Juan Manuel González-Rosa (Addgene plasmid # 238375 ; http://n2t.net/addgene:238375 ; RRID:Addgene_238375) -
For your References section:
Rapid and robust generation of cardiomyocyte-specific crispants in zebrafish using the cardiodeleter system. Keeley S, Fernandez-Lajarin M, Bergemann D, John N, Parrott L, Andrea BE, Gonzalez-Rosa JM. Cell Rep Methods. 2025 Mar 24;5(3):101003. doi: 10.1016/j.crmeth.2025.101003. 10.1016/j.crmeth.2025.101003 PubMed 40132543