Skip to main content

pTol1-U6abc_amhc(myh6)_cmlc2-nmKate
(Plasmid #238375)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 238375 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tol1-based backbone
  • Total vector size (bp) 6610

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nuclear mKate/3 gRNAs targeting amhc
  • gRNA/shRNA sequence
    Amhc gA: gggcgcctggaggaggcagg; Amhc gB: ggGGAGCAGGCCGAGCCCGA; Amhc gC: ggGCAGGAGTTGCATCCGTT
  • Species
    D. rerio (zebrafish)
  • Promoter cmlc2 (nmKate); U6 (gRNAs)

Cloning Information

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol1-U6abc_amhc(myh6)_cmlc2-nmKate was a gift from Juan Manuel González-Rosa (Addgene plasmid # 238375 ; http://n2t.net/addgene:238375 ; RRID:Addgene_238375)
  • For your References section:

    Rapid and robust generation of cardiomyocyte-specific crispants in zebrafish using the cardiodeleter system. Keeley S, Fernandez-Lajarin M, Bergemann D, John N, Parrott L, Andrea BE, Gonzalez-Rosa JM. Cell Rep Methods. 2025 Mar 24;5(3):101003. doi: 10.1016/j.crmeth.2025.101003. 10.1016/j.crmeth.2025.101003 PubMed 40132543