Skip to main content

1M-Qt-eUnaG-TGA-rt20s-anti-mCherry(LaM-4)
(Plasmid #238894)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 238894 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA_Zeo
  • Total vector size (bp) 6981
  • Vector type
    Mammalian Expression, Affinity Reagent/ Antibody

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    1M-Qt-eUnaG-TGA-rt20s-anti-mCherry(LaM-4)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1M-Qt-eUnaG-TGA-rt20s-anti-mCherry(LaM-4) was a gift from Gil Westmeyer (Addgene plasmid # 238894 ; http://n2t.net/addgene:238894 ; RRID:Addgene_238894)
  • For your References section:

    Multiplexed genetic tags for electron and fluorescence microscopy. Berezin O, Piovesan A, Graf R, Samara E, Sigmund F, Westmeyer GG. Nat Protoc. 2025 Nov 19. doi: 10.1038/s41596-025-01260-7. 10.1038/s41596-025-01260-7 PubMed 41261217