1M-Qt-eUnaG-TGA-rt20s-anti-mCherry(LaM-4)
(Plasmid
#238894)
-
PurposeEMcapsulin class with a eUnaG fusion and an anti-mCherry intrabody (LaM-4) fusion preceded by a TGA stop codon and the rt20s readthrough motif.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA_Zeo
- Total vector size (bp) 6981
-
Vector typeMammalian Expression, Affinity Reagent/ Antibody
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name1M-Qt-eUnaG-TGA-rt20s-anti-mCherry(LaM-4)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1M-Qt-eUnaG-TGA-rt20s-anti-mCherry(LaM-4) was a gift from Gil Westmeyer (Addgene plasmid # 238894 ; http://n2t.net/addgene:238894 ; RRID:Addgene_238894) -
For your References section:
Multiplexed genetic tags for electron and fluorescence microscopy. Berezin O, Piovesan A, Graf R, Samara E, Sigmund F, Westmeyer GG. Nat Protoc. 2025 Nov 19. doi: 10.1038/s41596-025-01260-7. 10.1038/s41596-025-01260-7 PubMed 41261217