Cerulean-fLIN28A
(Plasmid
#238912)
-
PurposeContains Cerulean-fLIN28A fluorogenic protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 238912 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCerulean-fLIN28A
-
SpeciesSynthetic
- Promoter miniCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed) (unknown if destroyed)
- 3′ cloning site EcoRI (not destroyed) (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cerulean-fLIN28A was a gift from Jian-Hui Jiang (Addgene plasmid # 238912 ; http://n2t.net/addgene:238912 ; RRID:Addgene_238912) -
For your References section:
Fluorogenic Interacting Protein Stabilization for Orthogonal RNA Imaging. Zhou WJ, Wu MY, Shao XJ, Tang LJ, Wang F, Jiang JH. Angew Chem Int Ed Engl. 2025 Apr 10:e202502350. doi: 10.1002/anie.202502350. 10.1002/anie.202502350 PubMed 40208703