Skip to main content

pNS2_Ptrc::lasI
(Plasmid #239008)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239008 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAM1579
  • Backbone size w/o insert (bp) 9691
  • Total vector size (bp) 10322
  • Modifications to backbone
    Added LacI gene, and a Ptrc promoter, with rrnB terminator
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Acyl-homoserine-lactone synthase, 3OC12-HSL
  • Alt name
    LasI
  • Species
    Pseudomonas aeruginosa
  • Insert Size (bp)
    607
  • Promoter Ptrc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggcagccatcggaagctgtg
  • 3′ sequencing primer catcaaattaagcagaaggccatcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.04.03.647055 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNS2_Ptrc::lasI was a gift from Daniel Ducat (Addgene plasmid # 239008 ; http://n2t.net/addgene:239008 ; RRID:Addgene_239008)
  • For your References section:

    Engineering quorum-sensing circuits in Synechococcus elongatus PCC 7942 towards self-inducible systems. Kokarakis EJ, Santos-Merino M, Ghaffarinasab S, Vocelle D, Ducat DC. Metab Eng. 2025 Nov;92:76-89. doi: 10.1016/j.ymben.2025.07.008. Epub 2025 Jul 25. 10.1016/j.ymben.2025.07.008 PubMed 40716565