Skip to main content

pNS3_Ptrc::luxR _Plux::Cdv3/GFP
(Plasmid #239009)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239009 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHN1_lacUV5
  • Backbone size w/o insert (bp) 4861
  • Total vector size (bp) 7136
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Transcriptional activator luxR
  • Alt name
    luxR
  • Species
    Vibrio fischeri
  • Insert Size (bp)
    756
  • Promoter Ptrc

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    DivIVA-like cell division regulating protein
  • Alt name
    cdv3
  • Species
    Synechococcus elongatus pcc 7942
  • Insert Size (bp)
    1401
  • Promoter PluxI
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTAGCAAGGGTCCGGGTTCA
  • 3′ sequencing primer cggtgagctggtgatatgggat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.04.03.647055 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNS3_Ptrc::luxR _Plux::Cdv3/GFP was a gift from Daniel Ducat (Addgene plasmid # 239009 ; http://n2t.net/addgene:239009 ; RRID:Addgene_239009)
  • For your References section:

    Engineering quorum-sensing circuits in Synechococcus elongatus PCC 7942 towards self-inducible systems. Kokarakis EJ, Santos-Merino M, Ghaffarinasab S, Vocelle D, Ducat DC. Metab Eng. 2025 Nov;92:76-89. doi: 10.1016/j.ymben.2025.07.008. Epub 2025 Jul 25. 10.1016/j.ymben.2025.07.008 PubMed 40716565