pNS3_Ptrc::luxR _Plux::Cdv3/GFP
(Plasmid
#239009)
-
PurposeCell elongation, under LuxR control, activation by 3OC6-HSL and 3OC12-HSL
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHN1_lacUV5
- Backbone size w/o insert (bp) 4861
- Total vector size (bp) 7136
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTranscriptional activator luxR
-
Alt nameluxR
-
SpeciesVibrio fischeri
-
Insert Size (bp)756
- Promoter Ptrc
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcgggaatcgtagcaaagtc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDivIVA-like cell division regulating protein
-
Alt namecdv3
-
SpeciesSynechococcus elongatus pcc 7942
-
Insert Size (bp)1401
- Promoter PluxI
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAGCAAGGGTCCGGGTTCA
- 3′ sequencing primer cggtgagctggtgatatgggat
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.04.03.647055 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNS3_Ptrc::luxR _Plux::Cdv3/GFP was a gift from Daniel Ducat (Addgene plasmid # 239009 ; http://n2t.net/addgene:239009 ; RRID:Addgene_239009) -
For your References section:
Engineering quorum-sensing circuits in Synechococcus elongatus PCC 7942 towards self-inducible systems. Kokarakis EJ, Santos-Merino M, Ghaffarinasab S, Vocelle D, Ducat DC. Metab Eng. 2025 Nov;92:76-89. doi: 10.1016/j.ymben.2025.07.008. Epub 2025 Jul 25. 10.1016/j.ymben.2025.07.008 PubMed 40716565