pNS2_Ptrc::luxI
(Plasmid
#239010)
-
Purpose3OC6-HSL quorum sensing signal producer under Ptrc inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAM1579
- Backbone size w/o insert (bp) 9691
- Total vector size (bp) 10268
-
Modifications to backboneAdded LacI gene, and a Ptrc promoter, with rrnB terminator
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAcyl-homoserine-lactone synthase, 3OC6-HSL
-
Alt nameluxI
-
SpeciesVibrio fischeri
-
Insert Size (bp)589
- Promoter Ptrc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggcagccatcggaagctgtg
- 3′ sequencing primer catcaaattaagcagaaggccatcctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.04.03.647055 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNS2_Ptrc::luxI was a gift from Daniel Ducat (Addgene plasmid # 239010 ; http://n2t.net/addgene:239010 ; RRID:Addgene_239010) -
For your References section:
Engineering quorum-sensing circuits in Synechococcus elongatus PCC 7942 towards self-inducible systems. Kokarakis EJ, Santos-Merino M, Ghaffarinasab S, Vocelle D, Ducat DC. Metab Eng. 2025 Nov;92:76-89. doi: 10.1016/j.ymben.2025.07.008. Epub 2025 Jul 25. 10.1016/j.ymben.2025.07.008 PubMed 40716565