pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
(Plasmid
#239029)
-
PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 6857
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesesRNA for mouse Rorb
-
gRNA/shRNA sequencetacgatctcagacattgttatcccgggagcgaactgcccgttgttgaaagagctataggtaaacaagttgggtacagatgtgaggtcatagataggttcttgctttatctgtttgatcccagtcatgtccagctcctgactgatcgggagacggctgaccggaatctatgctgtaataaccttcggacttAggcaggtcaatgcgtgcccgttggcgtatgtgccgccggtctcggtgttcaggttgctgaggccattgctaatgctgctgctgtacaccctggcgagggcctccgcctccccactctgctgctgccgctgctcctgcagcctttgctgaggcttctgcacctcagcatacaggctgtcccgctgcttcttggacatcctccc
-
SpeciesM. musculus (mouse)
-
Entrez GeneRorb (a.k.a. Nr1f2, RZR-beta, RZRB, Rorbeta, hstp)
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer catcacctcccacaacgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE was a gift from Josh Huang (Addgene plasmid # 239029 ; http://n2t.net/addgene:239029 ; RRID:Addgene_239029) -
For your References section:
Programmable RNA sensing for cell monitoring and manipulation. Qian Y, Li J, Zhao S, Matthews EA, Adoff M, Zhong W, An X, Yeo M, Park C, Yang X, Wang BS, Southwell DG, Huang ZJ. Nature. 2022 Oct;610(7933):713-721. doi: 10.1038/s41586-022-05280-1. Epub 2022 Oct 5. 10.1038/s41586-022-05280-1 PubMed 36198803