p15GFPkv
(Plasmid
#239039)
-
PurposeExpresses a + positively charged GFP variant (+15GFPKv) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmaxCloning
-
Backbone manufacturerLonza
- Total vector size (bp) 3599
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep15GFPKv-NES
-
Alt name+15GFPKv
-
Alt name+15GFP-Kv
-
SpeciesSynthetic
-
Insert Size (bp)802
-
MutationAll surface-exposed Arg residues changed to Lysine
- Promoter CMV
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer aggaggccaatagaaactggg
- 3′ sequencing primer gaatgcaattgttgttgttaacttgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p15GFPkv was a gift from Felipe Quiroz (Addgene plasmid # 239039 ; http://n2t.net/addgene:239039 ; RRID:Addgene_239039) -
For your References section:
Genetically-Encoded Phase Separation Sensors Enable High-Fidelity Live-Cell Probing of Biomolecular Condensates. Avecilla ARC, Thomas J, Quiroz FG. ACS Sens. 2025 Mar 28;10(3):1857-1869. doi: 10.1021/acssensors.4c02851. Epub 2025 Feb 23. 10.1021/acssensors.4c02851 PubMed 39987501