Skip to main content
Addgene

pccGFP-MalE-neg-1E11
(Plasmid #239083)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239083 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pccGFPKAN
  • Backbone size w/o insert (bp) 7375
  • Total vector size (bp) 7426
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Transmembrane domain of CEA20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    51
  • Mutation
    Changed Alanine 457 to Phenylalanine, and deleted amino acids 451-454
  • Tags / Fusion Proteins
    • ToxR (N terminal on backbone)
    • MBP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer acggttgaagaagagatggctcgc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pccGFP-MalE-neg-1E11 was a gift from Alessandro Senes (Addgene plasmid # 239083 ; http://n2t.net/addgene:239083 ; RRID:Addgene_239083)

  • For your References section:

    High-throughput discovery of transmembrane helix dimers from human single-pass membrane proteins with TOXGREEN sort-seq. Anderson SM, Choi J, Cushman EM, Leander M, Raman S, Senes A. bioRxiv 2025.04.22.650048 10.1101/2025.04.22.650048
Related items: