Skip to main content

pccGFP-MalE-neg-2E11
(Plasmid #239084)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239084 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pccGFPKAN
  • Backbone size w/o insert (bp) 7375
  • Total vector size (bp) 7438
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    transmembrane domain of LRIG3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    63
  • Mutation
    Changed Valine 827 to Isoleucine
  • Tags / Fusion Proteins
    • ToxR (N terminal on backbone)
    • MBP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer acggttgaagaagagatggctcgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pccGFP-MalE-neg-2E11 was a gift from Alessandro Senes (Addgene plasmid # 239084 ; http://n2t.net/addgene:239084 ; RRID:Addgene_239084)
  • For your References section:

    High-throughput discovery of transmembrane helix dimers from human single-pass membrane proteins with TOXGREEN sort-seq. Anderson SM, Choi J, Cushman EM, Leander M, Raman S, Senes A. bioRxiv 2025.04.22.650048 10.1101/2025.04.22.650048