pccGFP-MalE-pos-2H07
(Plasmid
#239088)
-
PurposePositive control for liquid MalE complementation assay
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepccGFPKAN
- Backbone size w/o insert (bp) 7375
- Total vector size (bp) 7438
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametransmembrane domain of FND10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)63
-
MutationChanged Valine 184 to Isoleucine
-
Tags
/ Fusion Proteins
- ToxR (N terminal on backbone)
- MBP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer acggttgaagaagagatggctcgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pccGFP-MalE-pos-2H07 was a gift from Alessandro Senes (Addgene plasmid # 239088 ; http://n2t.net/addgene:239088 ; RRID:Addgene_239088) -
For your References section:
High-throughput discovery of transmembrane helix dimers from human single-pass membrane proteins with TOXGREEN sort-seq. Anderson SM, Choi J, Cushman EM, Leander M, Raman S, Senes A. bioRxiv 2025.04.22.650048 10.1101/2025.04.22.650048