Skip to main content
Addgene

P532_POU4F2-p2A-tdTomato-p2A-Thy1.2
(Plasmid #239102)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239102 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 6556
  • Vector type
    Mammalian Expression ; Donor plasmid for integration into the human genome at the POU4F2 gene.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POU4F2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2049
  • Entrez Gene
    POU4F2 (a.k.a. BRN3.2, BRN3B, Brn-3b)
  • Promoter Endogenous POU4F2
  • Tag / Fusion Protein
    • p2A-tdTomato-p2A-Thy1.2 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTAGTGCGCGAGCAAAAT
  • 3′ sequencing primer GCCTAGGCGGTATCTTCACA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P532_POU4F2-p2A-tdTomato-p2A-Thy1.2 was a gift from Karl Wahlin (Addgene plasmid # 239102 ; http://n2t.net/addgene:239102 ; RRID:Addgene_239102)

  • For your References section:

    CRISPR Generated SIX6 and POU4F2 Reporters Allow Identification of Brain and Optic Transcriptional Differences in Human PSC-Derived Organoids. Wahlin KJ, Cheng J, Jurlina SL, Jones MK, Dash NR, Ogata A, Kibria N, Ray S, Eldred KC, Kim C, Heng JS, Phillips J, Johnston RJ Jr, Gamm DM, Berlinicke C, Zack DJ. Front Cell Dev Biol. 2021 Nov 16;9:764725. doi: 10.3389/fcell.2021.764725. eCollection 2021. 10.3389/fcell.2021.764725 PubMed 34869356
Related items: