Skip to main content
Addgene

P527_POU4F2-p2A-mNeonGreen-h2b
(Plasmid #239103)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239103 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5691
  • Modifications to backbone
    A p2A-mNeonGreen-h2b was added before the stop codon of POU4F2.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POU4F2
  • Alt name
    BRN3B
  • Species
    H. sapiens (human)
  • Entrez Gene
    POU4F2 (a.k.a. BRN3.2, BRN3B, Brn-3b)
  • Promoter Endogenous POU4F2
  • Tag / Fusion Protein
    • p2A-mNeonGreen-h2b (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTAGTGCGCGAGCAAAAT
  • 3′ sequencing primer TAGGCTGGTTGCTGACTAATTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P527_POU4F2-p2A-mNeonGreen-h2b was a gift from Karl Wahlin (Addgene plasmid # 239103 ; http://n2t.net/addgene:239103 ; RRID:Addgene_239103)
  • For your References section:

    Human retinal ganglion cell neurons generated by synchronous BMP inhibition and transcription factor mediated reprogramming. Agarwal D, Dash N, Mazo KW, Chopra M, Avila MP, Patel A, Wong RM, Jia C, Do H, Cheng J, Chiang C, Jurlina SL, Roshan M, Perry MW, Rho JM, Broyer R, Lee CD, Weinreb RN, Gavrilovici C, Oesch NW, Welsbie DS, Wahlin KJ. NPJ Regen Med. 2023 Sep 29;8(1):55. doi: 10.1038/s41536-023-00327-x. 10.1038/s41536-023-00327-x PubMed 37773257