pCAD183_gCAD_pET
(Plasmid
#239119)
-
PurposeGorilla ACOD1 in E.coli expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-T7pro-ter
- Total vector size (bp) 5251
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameACOD1
-
Alt nameIRG1
-
SpeciesGorilla gorilla gorilla
-
Insert Size (bp)1533
-
GenBank IDXM_004054615
- Promoter T7
-
Tag
/ Fusion Protein
- StrepTag-II and TEV site (N terminal on backbone)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer ATGCGTCCGGCGTAG
- 3′ sequencing primer GATATAGTTCCTCCTTTCAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAD183_gCAD_pET was a gift from Konrad Buessow (Addgene plasmid # 239119 ; http://n2t.net/addgene:239119 ; RRID:Addgene_239119) -
For your References section:
Amino acid positions near the active site determine the reduced activity of human ACOD1 compared to murine ACOD1. Chen F, Yalcin I, Zhao M, Chen C, Blankenfeldt W, Pessler F, Bussow K. Sci Rep. 2023 Jun 26;13(1):10360. doi: 10.1038/s41598-023-37373-w. 10.1038/s41598-023-37373-w PubMed 37365251