pCAD182_gCAD_pCMV6-entry
(Plasmid
#239122)
-
PurposeGorilla ACOD1 in mammalian expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV6-Entry
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 4831
- Total vector size (bp) 6274
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACOD1
-
Alt nameIRG1
-
SpeciesGorilla gorilla gorilla
-
Insert Size (bp)1533
-
GenBank IDXM_004054615
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc (C terminal on backbone)
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGGAAACAGCTATGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAD182_gCAD_pCMV6-entry was a gift from Konrad Buessow (Addgene plasmid # 239122 ; http://n2t.net/addgene:239122 ; RRID:Addgene_239122) -
For your References section:
Amino acid positions near the active site determine the reduced activity of human ACOD1 compared to murine ACOD1. Chen F, Yalcin I, Zhao M, Chen C, Blankenfeldt W, Pessler F, Bussow K. Sci Rep. 2023 Jun 26;13(1):10360. doi: 10.1038/s41598-023-37373-w. 10.1038/s41598-023-37373-w PubMed 37365251