pAAV-hSyn-mTurquoise2
(Plasmid
#239206)
-
PurposeAAV construct used as a cell filler to label neurons with mTurquoise2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-Syn-iCre; Addgene #122518
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 5040
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemTurquoise2
-
SpeciesSynthetic
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAGCGCTGCCTCAGTCTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence for mTurquoise2 is from Goedhart et al., 2012 (doi: https://doi.org/10.1038/ncomms1738)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-mTurquoise2 was a gift from Erin O'Shea (Addgene plasmid # 239206 ; http://n2t.net/addgene:239206 ; RRID:Addgene_239206)