pAAV-hSyn-TeTxLC-P2A-mTurquoise2
(Plasmid
#239210)
-
PurposeExpresses tetanus toxin light chain in neurons to inhibit synapse activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-Syn-iCre; Addgene #122518
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsthe E.coli carrying this plasmid grow very slowly
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTeTxLC-P2A-mTurquoise2
-
Alt nameTetanus toxin light chain
-
SpeciesSynthetic; Clostridium tetani
-
Insert Size (bp)2200
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAGCGCTGCCTCAGTCTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe TetxLC-P2A fragment was obtaind via PCR from Addgene plasmid pAAV-hSyn-FLEX-TeLC-P2A-dTomato (a gift from Sandeep Datta (Addgene plasmid # 159102 ; http://n2t.net/addgene:159102 ; RRID:Addgene_159102)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-TeTxLC-P2A-mTurquoise2 was a gift from Erin O'Shea (Addgene plasmid # 239210 ; http://n2t.net/addgene:239210 ; RRID:Addgene_239210)