Skip to main content

pLJC2-HK2 (D209A, D657A)-3xFLAG
(Plasmid #239244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239244 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLJC2
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HK2
  • Species
    H. sapiens (human)
  • Mutation
    Insert contains the set of silent mutations described for pLJC2-HK2-3xFLAG. In addition, the wild-type codons corresponding to D209 (GAC) and D657 (GAC) were mutated to A209 (GCC) and A657 (GCC) and D657 by site-directed mutagenesis.
  • Entrez Gene
    HK2 (a.k.a. HKII, HXK2)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
  • 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJC2-HK2 (D209A, D657A)-3xFLAG was a gift from Jason Cantor (Addgene plasmid # 239244 ; http://n2t.net/addgene:239244 ; RRID:Addgene_239244)
  • For your References section:

    Hexokinase detachment from mitochondria drives the Warburg effect to support compartmentalized ATP production. Huggler KS, Flickinger KM, Forsberg MH, Mellado Fritz CA, Chang GR, McGuire MF, Capitini CM, Cantor JR. Nat Metab. 2026 Jan 16. doi: 10.1038/s42255-025-01428-1. 10.1038/s42255-025-01428-1 PubMed 41545565