Skip to main content
Addgene

TDH3pro-rtTA-tetO7pro-T7pol-pRS413
(Plasmid #239293)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239293 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS413
  • Backbone size w/o insert (bp) 4970
  • Total vector size (bp) 10236
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    T7 polymerase with NLS and P278L
  • Insert Size (bp)
    2688
  • Mutation
    NLS between amino acids 11 and 12; T278L
  • Promoter tetracycline-responsive element (TRE) and CYC1 promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGGTAATATAGATCAATTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    reverse tetracycline transactivator (rtTA)
  • Insert Size (bp)
    1014
  • Mutation
    Contains M2-SE-G72P mutations, described in Addgene Plasmid #177924
  • Promoter TDH3

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGCCGCCGGTATCGATAAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TDH3pro-rtTA-tetO7pro-T7pol-pRS413 was a gift from Anita Hopper (Addgene plasmid # 239293 ; http://n2t.net/addgene:239293 ; RRID:Addgene_239293)
  • For your References section:

    Free introns of tRNAs as complementarity-dependent regulators of gene expression. Nostramo RT, Sinopoli PL, Bao A, Metcalf S, Peltier LM, Hopper AK. Mol Cell. 2025 Feb 20;85(4):726-741.e6. doi: 10.1016/j.molcel.2025.01.019. Epub 2025 Feb 11. 10.1016/j.molcel.2025.01.019 PubMed 39938518