TDH3pro-rtTA-tetO7pro-T7pol-pRS413
(Plasmid
#239293)
-
PurposeExpresses the reverse tetracycline activator (rtTA) and T7 polymerase; Plasmid #1 of the tet-on overexpression system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS413
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 10236
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameT7 polymerase with NLS and P278L
-
Insert Size (bp)2688
-
MutationNLS between amino acids 11 and 12; T278L
- Promoter tetracycline-responsive element (TRE) and CYC1 promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGGTAATATAGATCAATTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namereverse tetracycline transactivator (rtTA)
-
Insert Size (bp)1014
-
MutationContains M2-SE-G72P mutations, described in Addgene Plasmid #177924
- Promoter TDH3
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGCCGCCGGTATCGATAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TDH3pro-rtTA-tetO7pro-T7pol-pRS413 was a gift from Anita Hopper (Addgene plasmid # 239293 ; http://n2t.net/addgene:239293 ; RRID:Addgene_239293) -
For your References section:
Free introns of tRNAs as complementarity-dependent regulators of gene expression. Nostramo RT, Sinopoli PL, Bao A, Metcalf S, Peltier LM, Hopper AK. Mol Cell. 2025 Feb 20;85(4):726-741.e6. doi: 10.1016/j.molcel.2025.01.019. Epub 2025 Feb 11. 10.1016/j.molcel.2025.01.019 PubMed 39938518