Skip to main content

LentiCRISPR-B_sgRNA_EXOSC10 (pAVA3318)
(Plasmid #239295)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239295 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPR-B
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6-driven sgRNA targeting EXOSC10
  • gRNA/shRNA sequence
    TAATGTTGCTGCGACACCCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    EXOSC10 (a.k.a. PM-Scl, PM/Scl-100, PMSCL, PMSCL2, RRP6, Rrp6p, p2, p3, p4)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.09.26.615073 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR-B_sgRNA_EXOSC10 (pAVA3318) was a gift from Andrei Alexandrov (Addgene plasmid # 239295 ; http://n2t.net/addgene:239295 ; RRID:Addgene_239295)
  • For your References section:

    Identification of human pathways acting on nuclear non-coding RNAs using the Mirror forward genetic approach. Che R, Panah M, Mirani B, Knowles K, Ostapovich A, Majumdar D, Chen X, DeSimone J, White W, Noonan M, Luo H, Alexandrov A. Nat Commun. 2025 May 22;16(1):4741. doi: 10.1038/s41467-025-59998-3. 10.1038/s41467-025-59998-3 PubMed 40399278