LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
(Plasmid
#239303)
-
PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPR-B
-
Vector typeLentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-driven sgRNA targeting EXOSC5
-
gRNA/shRNA sequenceCCCCCGCACCTCCATCACCG
-
SpeciesH. sapiens (human)
-
Entrez GeneEXOSC5 (a.k.a. CABAC, RRP41B, RRP46, Rrp46p, hRrp46p, p12B)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTCTTGGGTAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.26.615073 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068) was a gift from Andrei Alexandrov (Addgene plasmid # 239303 ; http://n2t.net/addgene:239303 ; RRID:Addgene_239303) -
For your References section:
Identification of human pathways acting on nuclear non-coding RNAs using the Mirror forward genetic approach. Che R, Panah M, Mirani B, Knowles K, Ostapovich A, Majumdar D, Chen X, DeSimone J, White W, Noonan M, Luo H, Alexandrov A. Nat Commun. 2025 May 22;16(1):4741. doi: 10.1038/s41467-025-59998-3. 10.1038/s41467-025-59998-3 PubMed 40399278