pXYB033
(Plasmid
#239387)
-
PurposeSuper folding Green Fluorescence Protein (sfGFP)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAMBIA1305.1
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSuperfolder GFP
-
Entrez Genegfp (a.k.a. pCmGFP_001)
- Promoter 35S
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAATCAAGATTAAAGTTAATTAAATGAGCAAAGGAGAAGAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXYB033 was a gift from Xiaohan Yang (Addgene plasmid # 239387 ; http://n2t.net/addgene:239387 ; RRID:Addgene_239387) -
For your References section:
A split ribozyme system for in vivo plant RNA imaging and genetic engineering. Liu Y, Rajput R, Islam MT, Valle ID, Yao T, Agrawal R, Boone BA, Eckert CA, Abraham PE, Chen JG, Tuskan GA, Yang X. Plant Biotechnol J. 2025 May;23(5):1640-1649. doi: 10.1111/pbi.14612. Epub 2025 Feb 7. 10.1111/pbi.14612 PubMed 39919021