pLP16_Lenti Scramble Control
(Plasmid
#239417)
-
PurposeNegative control Lentiviral plasmid for SpCas9-based CRISPR KO
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2 (Plasmid #52961)
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameScramble sequence
-
gRNA/shRNA sequenceACGGAGGCTAAGCGTCGCAA
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLP16_Lenti Scramble Control was a gift from Subhojit Roy (Addgene plasmid # 239417 ; http://n2t.net/addgene:239417 ; RRID:Addgene_239417) -
For your References section:
Protocol for CRISPR-based manipulation and visualization of endogenous alpha-synuclein in cultured mouse hippocampal neurons. Parra-Rivas LA, Sharma R, Rust TE, Bazick HO, Carlson-Stevermer J, Zylka MJ, Ogawa Y, Roy S. STAR Protoc. 2025 Jul 21;6(3):103945. doi: 10.1016/j.xpro.2025.103945. 10.1016/j.xpro.2025.103945 PubMed 40700012