Skip to main content
Addgene

pLP16_Lenti Scramble Control
(Plasmid #239417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2 (Plasmid #52961)
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scramble sequence
  • gRNA/shRNA sequence
    ACGGAGGCTAAGCGTCGCAA

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLP16_Lenti Scramble Control was a gift from Subhojit Roy (Addgene plasmid # 239417 ; http://n2t.net/addgene:239417 ; RRID:Addgene_239417)
  • For your References section:

    Protocol for CRISPR-based manipulation and visualization of endogenous alpha-synuclein in cultured mouse hippocampal neurons. Parra-Rivas LA, Sharma R, Rust TE, Bazick HO, Carlson-Stevermer J, Zylka MJ, Ogawa Y, Roy S. STAR Protoc. 2025 Jul 21;6(3):103945. doi: 10.1016/j.xpro.2025.103945. 10.1016/j.xpro.2025.103945 PubMed 40700012