Skip to main content
Addgene
Open Menu

pAAV-CMV-DIO-SaCas9-U6-sgDagla
(Plasmid #239421)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239421 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    PX601-AAV-CMV::NLS-SaCas9-NLS- 3xHA-bGHpA;U6::BsaI-sgRNA
  • Total vector size (bp) 7481
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    diacylglycerol lipase, alpha
  • Alt name
    Nsddr
  • gRNA/shRNA sequence
    ATGGTCCACAGCTACGTAGAA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_198114.2
  • Entrez Gene
    Dagla (a.k.a. Nsddr)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknow (unknown if destroyed)
  • 3′ cloning site Unknow (unknown if destroyed)
  • 5′ sequencing primer U6F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-DIO-SaCas9-U6-sgDagla was a gift from Huaibin Cai (Addgene plasmid # 239421 ; http://n2t.net/addgene:239421 ; RRID:Addgene_239421)

  • For your References section:

    Deficiency in endocannabinoid synthase DAGLB contributes to early onset Parkinsonism and murine nigral dopaminergic neuron dysfunction. Liu Z, Yang N, Dong J, Tian W, Chang L, Ma J, Guo J, Tan J, Dong A, He K, Zhou J, Cinar R, Wu J, Salinas AG, Sun L, Kumar M, Sullivan BT, Oldham BB, Pitz V, Makarious MB, Ding J, Kung J, Xie C, Hawes SL, Wang L, Wang T, Chan P, Zhang Z, Le W, Chen S, Lovinger DM, Blauwendraat C, Singleton AB, Cui G, Li Y, Cai H, Tang B. Nat Commun. 2022 Jun 17;13(1):3490. doi: 10.1038/s41467-022-31168-9. 10.1038/s41467-022-31168-9 PubMed 35715418
Related items: