Skip to main content

pAAV-N-RAM-CytoTape-V5
(Plasmid #239425)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 239425 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pAAV-N-RAM
  • Backbone manufacturer
    Epoch Life Science, Inc.
  • Backbone size w/o insert (bp) 5890
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CytoTape-V5
  • Species
    Synthetic
  • Promoter N-RAM promoter
  • Tag / Fusion Protein
    • V5-dMBP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGCGCAGATCGATAACTAGTGC
  • 3′ sequencing primer GCAAACAACAGATGGCTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.05.10.653182 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-N-RAM-CytoTape-V5 was a gift from Changyang Linghu (Addgene plasmid # 239425 ; http://n2t.net/addgene:239425 ; RRID:Addgene_239425)
  • For your References section:

    Multiplexed, scalable analog recording of gene regulation dynamics over weeks using intracellular protein tapes. Zheng L, Yan Y, Zhou B, Lim J, Shi D, An B, Ko B, Klyder E, Pitchiaya S, Cai DJ, Boyden ES, Wei D, Lio P, Linghu C. bioRxiv [Preprint]. 2025 May 10:2025.05.10.653182. doi: 10.1101/2025.05.10.653182. 10.1101/2025.05.10.653182 PubMed 40654887