pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
(Plasmid
#239448)
-
PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 4361
- Total vector size (bp) 9810
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameS.p. gRNA backbone
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)113
- Promoter mU6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site BlpI (not destroyed)
- 5′ sequencing primer CAGCACAAAAGGAAACTCACC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameS.a. gRNA backbone
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)111
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Golden Gate
- 5′ sequencing primer tacgtgacgtagaaagtaat
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePuroR-T2A-BFP(C>T_screening)
-
SpeciesSynthetic
-
Insert Size (bp)1389
-
MutationBFP: T65S, S72S, V145F, K206K, H231L
- Promoter EF1alpha
Cloning Information for Gene/Insert 3
- Cloning method Other
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening)) was a gift from Alexis Komor (Addgene plasmid # 239448 ; http://n2t.net/addgene:239448 ; RRID:Addgene_239448)