pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
(Plasmid #239448)

• Purpose: Orthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.
• Depositing Lab: Alexis Komor
• Publication: Elucidating the genetic mechanisms governing cytosine base editing outcomes through CRISPRi screens (unpublished)

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 4361
• Total vector size (bp): 9810
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: S.p. gRNA backbone
• Species: Streptococcus pyogenes
• Insert Size (bp): 113
• Promoter: mU6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstXI (not destroyed)
• 3′ cloning site: BlpI (not destroyed)
• 5′ sequencing primer: CAGCACAAAAGGAAACTCACC

Gene/Insert 2

• Gene/Insert name: S.a. gRNA backbone
• Species: Staphylococcus aureus
• Insert Size (bp): 111
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Golden Gate
• 5′ sequencing primer: tacgtgacgtagaaagtaat

Gene/Insert 3

• Gene/Insert name: PuroR-T2A-BFP(C>T_screening)
• Species: Synthetic
• Insert Size (bp): 1389
• Mutation: BFP: T65S, S72S, V145F, K206K, H231L
• Promoter: EF1alpha

Cloning Information for Gene/Insert 3

• Cloning method: Other
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • psg297-sp-sgrna-sa-grna_bsmbi-ef1a-puro-t2a-bfpct-screening.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry