pSG1017-2xBsaI-SaKKH-2xUGI_P2A_EGFP
(Plasmid
#239450)
-
Purpose(Empty Backbone) Codon-optimized S. aureus KKH Cas9 with 2x UGI. 2x BsaI sites for easy cloning of varying deaminases for cytosine base editing. EGFP can serve as a transfection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBR322
- Backbone size (bp) 4361
-
Vector typeMammalian Expression, CRISPR
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG1017-2xBsaI-SaKKH-2xUGI_P2A_EGFP was a gift from Alexis Komor (Addgene plasmid # 239450 ; http://n2t.net/addgene:239450 ; RRID:Addgene_239450)